Below is a segment of bacterial Lac Operon sequence. An E. coli transcript with the first 5 nucleotides 5′ AUGU3′. Carefully examine the sequence and then answer the questions. Strand A: 5’GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAAGTTAATCACACAGGAAACAGCTATGACCATGATT 3′ Strand B: 3’CGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTCAATTAGTGTGTCCTTTGTCGATACTGGTACTAA 5′ A. Where is the trascription start site? B. find TTTACA around -35 region and box it. (my answer is highlighted in yellow above) C. find TATGTT around -10 region and box it. (my answer highlighted pink above) D. lable template and coding strands (my answer: template is strand B and coding is strand A) E. does transcription elongation proceed towards the right or left? (my answer: right) F. write the sequence of the primary RNA transcript starting at 5′ aUUGU3′. include polarity of the transcript.
Absolutely spot on. I have had the best experience with Elite Academic Research and all my work have scored highly. Thank you for your professionalism and using expert writers with vast and outstanding knowledge in their fields. I highly recommend any day and time.
Stuart L
Thanks for keeping me sane for getting everything out of the way, I’ve been stuck working more than full time and balancing the rest but I’m glad you’ve been ensuring my school work is taken care of. I'll recommend Elite Academic Research to anyone who seeks quality academic help, thank you so much!
Mindi D
Brilliant writers and awesome support team. You can tell by the depth of research and the quality of work delivered that the writers care deeply about delivering that perfect grade.
Samuel Y
I really appreciate the work all your amazing writers do to ensure that my papers are always delivered on time and always of the highest quality. I was at a crossroads last semester and I almost dropped out of school because of the many issues that were bombarding but I am glad a friend referred me to you guys. You came up big for me and continue to do so. I just wish I knew about your services earlier.
Cindy L
You can't fault the paper quality and speed of delivery. I have been using these guys for the past 3 years and I not even once have they ever failed me. They deliver properly researched papers way ahead of time. Each time I think I have had the best their professional writers surprise me with even better quality work. Elite Academic Research is a true Gem among essay writing companies.
Got an A and plagiarism percent was less than 10%! Thanks!