Question 5
What is the key to the recognition of codominance?
A- The alleles affect more than one trait.
B- The phenotype of the heterozygote falls between the phenotypes of the homozygotes.
C- The heterozygote expresses the phenotype of both homozygotes.
D- The trait exhibits a continuous distribution.
E- The dominant allele is not always expressed.
Question 22
Answer the next questions using the pedigree below. Assume that deafness (dd) is caused by a single gene and is recessive to Hearing.
What would be the genotype of individual number 1?
A- None of the alleles can be determined
B- D_
C- dd
D- Dd
E- DD
Question 25
Answer the question using the pedigree above. Assume that deafness (dd) is caused by a single gene and is recessive to Hearing. Given that individual #4 and an another individual with genotype Dd are married and want to have children. What is the probability that they have a deaf girl?
A- 0%
B- Cannot be determined from the data
C- 50%
D- 25%
E- 12.5%
Question 26
My wife and I had three girls in a row, Amber, Melissa, and Camila and we recently had a little baby boy (so 3:1 ratio girls to boys). What is the chance that our next child (assume we have not determined the gender) will be male?
A- 25%
B- 33%
C- 67%
D- 50%
E- 75%
Question 30
Given the template DNA strand TACACCTCCCTACTACTCCCGGGATC, and that the string of bases CTACTACT represents an intron region. What is the mRNA processed transcript?
Ans:
Question 33
Based on the phylogenetic tree below, which of the following is most correct?
A- HIV is not related to SIV because Humans did not evolve from chimps
B- HIV evolved multiple times from SIV
C- Since humans are more evolved than chimps, HIV is more evolved than SIV
D- HIV M evolved from HIV O
Question 38
The image below shows evidence from a RFLP analysis from your DNA forensics lab. The defendant testified that the blood on his clothes was his own. What statement below best fits this testimony.
A- He has a valid point because some of the lines seem to match up.
B- It could have been anyone’s blood.
C- He is telling the truth because he is under oath
D- The pattern clearly shows that the blood matches the victims blood
E- There is no way to tell if the blood really is his because it had already dried
Question 41
What is the approximate probability of someone else having the same STR Profile as the one in this figure:
Use the table below to calculate the probability.
Locus Allele Frequency
D3S1358 12 0.015
D3S1358 13 0.015
D3S1358 14 0.1341
D3S1358 15 0.2896
D3S1358 16 0.2287
D3S1358 17 0.1616
D3S1358 18 0.1616
D3S1358 19 0.0152
VWA 12 0.015
VWA 14 0.1311
VWA 15 0.1189
VWA 16 0.186
VWA 17 0.2774
VWA 18 0.189
VWA 19 0.0884
VWA 20 0.015
FGA 18 0.015
FGA 19 0.061
FGA 20 0.125
FGA 21 0.1799
FGA 22 0.2287
FGA 23 0.1311
FGA 24 0.1463
FGA 25 0.0945
FGA 26 0.0183
FGA 27 0.015
A- 39 out of 10,000
B- 12 out of 1000
C- 12 out of a billion
D- 39 out of 1,000,000 people
Question 3
What is the difference between discovery science and hypothesis-driven science?
A- Discovery science involves predictions about outcomes, whereas hypothesis-driven science involves tentative answers to specific questions.
B- Discovery science is based on deductive reasoning, whereas hypothesis-driven science is based on inductive reasoning.
C- Discovery science “discovers” new knowledge, whereas hypothesis-driven science does not.
D- There is no difference between them.
E- Discovery science is mostly about describing nature, whereas hypothesis-driven science tries to explain nature.
Question 4
Aside from Natural selection, Darwin was the first biologist to propose:
A- Mutations in the genes can lead to new variation
B- genetic inheritance, stonger genes in parents lead to stronger genes in the offspring
C- Tree like structure to describe evolution
D- Darwin did not propose anything new aside from natural selection.
E- The evolution of species over time
Question 6
Which of these would Darwin not agree with:
A- The idea that individuals striving to survive leads to better adapted species
B- Evolution via natural selection requires long amounts of time
C- Common ancestry for all of life
D- Significant weight should be given to geology and fossils as evidence of evolution
Question 8
Natural selection always results in ______.
A- an increase in the size of a population
B- increased genetic variation
C- offspring better adapted to a future environment
D- a decrease in the size of a population
E- offspring better adapted to their parents’ environment than were their parents
Question 11
Which of the following is a characteristic of a non-trivial organization system?
A- Only experts in the field would be able to understand it
B- You get more out of it than what you put in it.
C- Tradition trumps new evidence
D- Organized alphabetically
Question 15
For the following questions, determine the ones that can be addressed by Science.
A- How old is the Earth?
B- What morphological characteristics were likely present in the common ancestor of humans and chimps?
C- Why was the Earth created?
D- How does coffee affect ulcers?
E- Are humans most closely related to chimpanzees?
Question 24
Identify each scenario as either a pre-zygotic or post-zygotic barrier to reproduction:
A- Populations never come into contact with each other
B- Offspring fail to reproduce
C- Male and female gametes fail to unite in fertilization.
D- Mating behaviors are not recognized by different organisms
E- Embryos are inviable and do not survive more than a few days
F- Genitalia structures are far too different to allow successful copulation
Question 25
Match the following species concept with one of its disadvantages.
A- Biological species concept
B- Phylogenetic species concept
C- Morphological species concept
Question 26
Which of the following are evidences that evolution has occurred (Mark all that apply): Choose at least one answer.
A- All of the different varieties of dogs that were artificially selected
B- Relatively young earth – less than 10 thousand years.
C- The fossil record
D- Adaptations acquired during life passed on to offspring
E- ack of homology among organisms
F- Marsupial radiation
G- All organisms share the same four DNA nucleotides (A T G C)
H- modern interpretation of the bible
I- Existence of vestigial organs
J- Humans evolving from modern day chimpanzee
Question 28
Mark all that apply: Which of the following is the equivalent to branching points on phylogenetic trees?
A- Speciation events
B- Nodes
C- Branches
D- Common ancestors
E- Internodes
Question 25
Which of the following best describes an enzyme?
A- They lower the amount of energy present in the substrate.
B- They lower the energy of activation of a reaction by binding the substrate.
C- They raise the energy of activation of a reaction by binding the substrate.
D- They heat up the reactants so that reactions occur at a greater speed.
Question 35
A pair of sex chromosomes found in a human male is most like
A- identical twins.
B- a pair of blue jeans.
C- a bride and groom.
D- a knife, fork, and spoon.
Question 46
What are the three main ingredients in photosynthesis?
A- Nitrogen
B- Carbon dioxide
C- Simple sugars
D- Oxygen
E- Light
F- ATP
G- Water








Jermaine Byrant
Nicole Johnson



