Please Have output in a word document with comments within the program! The following two questions are closely tiedtogether, you need to first finish question #1 in order to do question #2.Please write the data processing methods, such as codon() and codon2aa()in a separate Java class, and the input and output in another class.1. The genetic code of any organisms comprises of threenucleotides, also known as codon. Many gene-finding programs rely ontranslating a piece of DNA sequence in all possible reading frames and lookingfor the longest non-interrupted region of translation. Please develop a Javaprogram to read in a piece of DNA sequence from a FASTA format sequence file (hwk3.seq) andthen print out all the codons in three forward reading frames. Design a methodcalled codon() that canbe used to find all the codons from three reading frames. The method will takein an argument, the readingframe (1, 2, or 3), and return an array or ArrayList with all the codons. Allthe codons should have three nucleotides, please discard the last one if itdoes not have three nucleotides. Below is a sample output of the program: Pleaseenter the file name contains the DNA sequence:hwk3.seq  TheDNA sequence is:TCAGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC  Readingframe #1 codons are:TCAGCG AGA TGG GAA AGA TCA CCT TCT TCG AGG ACC GAG GCT TCC AGG  Readingframe #2 codons are:CAGCGA GAT GGG AAA GAT CAC CTT CTT CGA GGA CCG AGG CTT CCA GGG  Readingframe #3 codons are:AGC GAG ATG GGA AAG ATC ACCTTC TTC GAG GAC CGA GGC TTC CAG GGC2- . Please add another method called codon2aa() to modify the previousprogram (question #1) to print the corresponding amino acid beneath each codon.Use a single letter representation of the amino acid, and a * for the stoppingcodon. See below for a sample output. Pleaseenter the file name of DNA sequence:hwk3.seq  TheDNA sequence is:TCAGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC  Readingframe #1 codons and amino acids are:TCAGCG AGA TGG GAA AGA TCA CCT TCT TCG AGG ACC GAG GCT TCC AGGS A  R  W  E  R S  P  S  S  R T  E  A  S  R  Readingframe #2 codons and amino acids are:CAGCGA GAT GGG AAA GAT CAC CTT CTT CGA GGA CCG AGG CTT CCA GGGQ R  D  G  K  D H  L  L  R  G P  R  L  P  G  Readingframe #3 codons and amino acids are:AGCGAG ATG GGA AAG ATC ACC TTC TTC GAG GAC CGA GGC TTC CAG GGCS E  M  G  K  I T  F  F  E  D R  G  F  Q  G