Fill in Order Details

  • Submit paper details for free using our simple order form

Make Payment Securely

  • Add funds to your account. There are no upfront payments. The writer will only be paid once you have approved your paper

Writing Process

  • The best qualified expert writer is assigned to work on your order
  • Your paper is written to standard and delivered as per your instructions

Download your paper

  • Download the completed paper from your online account or your email
  • You can request a plagiarism and quality report along with your paper

What is the key to the recognition of codominance?

Question 5

What is the key to the recognition of codominance?

A- The alleles affect more than one trait.
B- The phenotype of the heterozygote falls between the phenotypes of the homozygotes.
C- The heterozygote expresses the phenotype of both homozygotes.
D- The trait exhibits a continuous distribution.
E- The dominant allele is not always expressed.

Question 22

Answer the next questions using the pedigree below. Assume that deafness (dd) is caused by a single gene and is recessive to Hearing.

What would be the genotype of individual number 1?

A- None of the alleles can be determined
B- D_
C- dd
D- Dd
E- DD

Question 25

Answer the question using the pedigree above. Assume that deafness (dd) is caused by a single gene and is recessive to Hearing. Given that individual #4 and an another individual with genotype Dd are married and want to have children. What is the probability that they have a deaf girl?

A- 0%
B- Cannot be determined from the data
C- 50%
D- 25%
E- 12.5%

Question 26

My wife and I had three girls in a row, Amber, Melissa, and Camila and we recently had a little baby boy (so 3:1 ratio girls to boys). What is the chance that our next child (assume we have not determined the gender) will be male?

A- 25%
B- 33%
C- 67%
D- 50%
E- 75%

Question 30

Given the template DNA strand TACACCTCCCTACTACTCCCGGGATC, and that the string of bases CTACTACT represents an intron region. What is the mRNA processed transcript?

Ans:

Question 33

Based on the phylogenetic tree below, which of the following is most correct?

A- HIV is not related to SIV because Humans did not evolve from chimps
B- HIV evolved multiple times from SIV
C- Since humans are more evolved than chimps, HIV is more evolved than SIV
D- HIV M evolved from HIV O

Question 38

The image below shows evidence from a RFLP analysis from your DNA forensics lab. The defendant testified that the blood on his clothes was his own. What statement below best fits this testimony.

A- He has a valid point because some of the lines seem to match up.
B- It could have been anyone’s blood.
C- He is telling the truth because he is under oath
D- The pattern clearly shows that the blood matches the victims blood
E- There is no way to tell if the blood really is his because it had already dried

Question 41

What is the approximate probability of someone else having the same STR Profile as the one in this figure:

Use the table below to calculate the probability.
Locus Allele Frequency
D3S1358 12 0.015
D3S1358 13 0.015
D3S1358 14 0.1341
D3S1358 15 0.2896
D3S1358 16 0.2287
D3S1358 17 0.1616
D3S1358 18 0.1616
D3S1358 19 0.0152

VWA 12 0.015
VWA 14 0.1311
VWA 15 0.1189
VWA 16 0.186
VWA 17 0.2774
VWA 18 0.189
VWA 19 0.0884
VWA 20 0.015

FGA 18 0.015
FGA 19 0.061
FGA 20 0.125
FGA 21 0.1799
FGA 22 0.2287
FGA 23 0.1311
FGA 24 0.1463
FGA 25 0.0945
FGA 26 0.0183
FGA 27 0.015

A- 39 out of 10,000
B- 12 out of 1000
C- 12 out of a billion
D- 39 out of 1,000,000 people

Question 3

What is the difference between discovery science and hypothesis-driven science?

A- Discovery science involves predictions about outcomes, whereas hypothesis-driven science involves tentative answers to specific questions.
B- Discovery science is based on deductive reasoning, whereas hypothesis-driven science is based on inductive reasoning.
C- Discovery science “discovers” new knowledge, whereas hypothesis-driven science does not.
D- There is no difference between them.
E- Discovery science is mostly about describing nature, whereas hypothesis-driven science tries to explain nature.

Question 4

Aside from Natural selection, Darwin was the first biologist to propose:

A- Mutations in the genes can lead to new variation
B- genetic inheritance, stonger genes in parents lead to stronger genes in the offspring
C- Tree like structure to describe evolution
D- Darwin did not propose anything new aside from natural selection.
E- The evolution of species over time

Question 6

Which of these would Darwin not agree with:

A- The idea that individuals striving to survive leads to better adapted species
B- Evolution via natural selection requires long amounts of time
C- Common ancestry for all of life
D- Significant weight should be given to geology and fossils as evidence of evolution

Question 8

Natural selection always results in ______.

A- an increase in the size of a population
B- increased genetic variation
C- offspring better adapted to a future environment
D- a decrease in the size of a population
E- offspring better adapted to their parents’ environment than were their parents

Question 11

Which of the following is a characteristic of a non-trivial organization system?

A- Only experts in the field would be able to understand it
B- You get more out of it than what you put in it.
C- Tradition trumps new evidence
D- Organized alphabetically
Question 15

For the following questions, determine the ones that can be addressed by Science.

A- How old is the Earth?
B- What morphological characteristics were likely present in the common ancestor of humans and chimps?
C- Why was the Earth created?
D- How does coffee affect ulcers?
E- Are humans most closely related to chimpanzees?

Question 24

Identify each scenario as either a pre-zygotic or post-zygotic barrier to reproduction:

A- Populations never come into contact with each other
B- Offspring fail to reproduce
C- Male and female gametes fail to unite in fertilization.
D- Mating behaviors are not recognized by different organisms
E- Embryos are inviable and do not survive more than a few days
F- Genitalia structures are far too different to allow successful copulation

Question 25

Match the following species concept with one of its disadvantages.

A- Biological species concept
B- Phylogenetic species concept
C- Morphological species concept

Question 26

Which of the following are evidences that evolution has occurred (Mark all that apply): Choose at least one answer.
A- All of the different varieties of dogs that were artificially selected
B- Relatively young earth – less than 10 thousand years.
C- The fossil record
D- Adaptations acquired during life passed on to offspring
E- ack of homology among organisms
F- Marsupial radiation
G- All organisms share the same four DNA nucleotides (A T G C)
H- modern interpretation of the bible
I- Existence of vestigial organs
J- Humans evolving from modern day chimpanzee

Question 28

Mark all that apply: Which of the following is the equivalent to branching points on phylogenetic trees?

A- Speciation events
B- Nodes
C- Branches
D- Common ancestors
E- Internodes

Question 25

Which of the following best describes an enzyme?

A- They lower the amount of energy present in the substrate.
B- They lower the energy of activation of a reaction by binding the substrate.
C- They raise the energy of activation of a reaction by binding the substrate.
D- They heat up the reactants so that reactions occur at a greater speed.

Question 35

A pair of sex chromosomes found in a human male is most like

A- identical twins.
B- a pair of blue jeans.
C- a bride and groom.
D- a knife, fork, and spoon.

Question 46

What are the three main ingredients in photosynthesis?

A- Nitrogen
B- Carbon dioxide
C- Simple sugars
D- Oxygen
E- Light
F- ATP
G- Water

 

 

WHAT OUR CURRENT CUSTOMERS SAY

  • Google
  • Sitejabber
  • Trustpilot
Zahraa S
Zahraa S
Absolutely spot on. I have had the best experience with Elite Academic Research and all my work have scored highly. Thank you for your professionalism and using expert writers with vast and outstanding knowledge in their fields. I highly recommend any day and time.
Stuart L
Stuart L
Thanks for keeping me sane for getting everything out of the way, I’ve been stuck working more than full time and balancing the rest but I’m glad you’ve been ensuring my school work is taken care of. I'll recommend Elite Academic Research to anyone who seeks quality academic help, thank you so much!
Mindi D
Mindi D
Brilliant writers and awesome support team. You can tell by the depth of research and the quality of work delivered that the writers care deeply about delivering that perfect grade.
Samuel Y
Samuel Y
I really appreciate the work all your amazing writers do to ensure that my papers are always delivered on time and always of the highest quality. I was at a crossroads last semester and I almost dropped out of school because of the many issues that were bombarding but I am glad a friend referred me to you guys. You came up big for me and continue to do so. I just wish I knew about your services earlier.
Cindy L
Cindy L
You can't fault the paper quality and speed of delivery. I have been using these guys for the past 3 years and I not even once have they ever failed me. They deliver properly researched papers way ahead of time. Each time I think I have had the best their professional writers surprise me with even better quality work. Elite Academic Research is a true Gem among essay writing companies.
Got an A and plagiarism percent was less than 10%! Thanks!

ORDER NOW


Consider Your Assignments Done

“All my friends and I are getting help from eliteacademicresearch. It’s every college student’s best kept secret!”

Jermaine Byrant
BSN

“I was apprehensive at first. But I must say it was a great experience and well worth the price. I got an A!”

Nicole Johnson
Finance & Economics

Our Top Experts

See Why Our Clients Hire Us Again And Again!


OVER

10.3k
Reviews

RATING
4.89/5
Average

YEARS
13
Mastery

Success Guarantee

When you order form the best, some of your greatest problems as a student are solved!

Reliable

Professional

Affordable

Quick

Using this writing service is legal and is not prohibited by any law, university or college policies. Services of Elite Academic Research are provided for research and study purposes only with the intent to help students improve their writing and academic experience. We do not condone or encourage cheating, academic dishonesty, or any form of plagiarism. Our original, plagiarism-free, zero-AI expert samples should only be used as references. It is your responsibility to cite any outside sources appropriately. This service will be useful for students looking for quick, reliable, and efficient online class-help on a variety of topics.