a scientist has discovered a human gene from cancer cells. the nucleotide sequence of the template strand of the gene was determined as written below: 3’gacacgtacgagcctggacaccttaagagcgggctcggaacactggccccgattgacac5′ (a) study the nucleotide sequence of the template strand and write sense strand (showing direction) of the gene. (b) write down the mrna produces from this gene. (c) how many amino acids will be present in the protein product of this gene. (d) write amino acid sequence of the polypeptide
Absolutely spot on. I have had the best experience with Elite Academic Research and all my work have scored highly. Thank you for your professionalism and using expert writers with vast and outstanding knowledge in their fields. I highly recommend any day and time.
Stuart L
Thanks for keeping me sane for getting everything out of the way, I’ve been stuck working more than full time and balancing the rest but I’m glad you’ve been ensuring my school work is taken care of. I'll recommend Elite Academic Research to anyone who seeks quality academic help, thank you so much!
Mindi D
Brilliant writers and awesome support team. You can tell by the depth of research and the quality of work delivered that the writers care deeply about delivering that perfect grade.
Samuel Y
I really appreciate the work all your amazing writers do to ensure that my papers are always delivered on time and always of the highest quality. I was at a crossroads last semester and I almost dropped out of school because of the many issues that were bombarding but I am glad a friend referred me to you guys. You came up big for me and continue to do so. I just wish I knew about your services earlier.
Cindy L
You can't fault the paper quality and speed of delivery. I have been using these guys for the past 3 years and I not even once have they ever failed me. They deliver properly researched papers way ahead of time. Each time I think I have had the best their professional writers surprise me with even better quality work. Elite Academic Research is a true Gem among essay writing companies.
Got an A and plagiarism percent was less than 10%! Thanks!