Fill in Order Details

  • Submit paper details for free using our simple order form

Make Payment Securely

  • Add funds to your account. There are no upfront payments. The writer will only be paid once you have approved your paper

Writing Process

  • The best qualified expert writer is assigned to work on your order
  • Your paper is written to standard and delivered as per your instructions

Download your paper

  • Download the completed paper from your online account or your email
  • You can request a plagiarism and quality report along with your paper

Write an article on DNA Barcoding Invertebrate

I will pay for the following article DNA Barcoding Invertebrate #1. The work is to be 2 pages with three to five sources, with in-text citations and a reference page. Biology Topic: lab report on DNA barcoding Introduction: DNA barcoding provides a versatile tool for ification of organism based on DNA taxonomy and delimitation and ‘discovery’ of new species. Sequences that are used as barcodes are usually those that are unique and conserved within a species. In DNA barcoding, usually a four staged approache is engaged. The first stage is to obtain a specimen which may be from from tissue or culture collections. In the second stage, laboratory analysis which involves extraction of genetic material to obtain DNA batcode sequence is done. These sequences are later placed in a barcode database such as the Barcode intiative to be used as species identifiers to assign unknown specimens to known species. Currently two such databases exists, the Barcode of life (BOLD) and The International Nucleotide Sequence Database Collaborative which is an intiative of the three main Nucleotide databases, GenBank, EMBL and DDBJ. The fouth and final stage is to carry out an analysis where specimens are identified with the closest matching reference record in the aforementioned databases.

In this lab report, we sought to perform a barcode analysis using mayfly DNA sequences in the BOLD database. The barcode sequence is mainly a short DNA sequence which has a uniform location in the genome and is used to identify species. One of the commonly used sequence in DNA barcoding is the cytochrome oxidase subunit 1 (COI). This was the sequence we used this work. The barcoding process involves identifying a universal locus which has retained enough sequence conservation throughout evolution and can be sourced from many organisms. This sequence should also be diverse so as to be competent enough to differentiate a target species to the family level. Generally regions of the chloroplast (rbcL gene) and the mitochondria (COI) meet these requirements. Various studies have been undertaken by Herbert et al (2003a, 2004b) and established this COI sequence as the sequence of choice in DNA barcoding in insects and vertebrates. Inverterbrates such as mayfly are collected whole and may be euthanized in a kill jar by placing them in a freezer. In the lab, primers are designed to target the conserved regions flanking the rbcL or the COI regions.

Examples of the barcoding primers which may be used in insects

5-GTAAAACGACGGCCAGTATTCAACCAATCATAAAGATATTGG-3 (forward primer – LepF1_t1)

5-TGTAAAACGACGGCCAGTTCTCAACCAACCACAAAGACATTGG-3 (forward primer – VF1_t1)

5-TGTAAAACGACGGCCAGTTCTCAACCAACCACAARGAYATYGG-3 (forward primer – VF1d_t1)

5-TGTAAAACGACGGCCAGTTCTCAACCAACCAIAAIGAIATIGG-3 (forward primer – VF1i_t1)

5-CAGGAAACAGCTATGACTAAACTTCTGGATGTCCAAAAAATCA-3 (reverse primer – LepR1_t1)

5-CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCRAARAAYCA-3 (reverse primer – VR1d_t1)

5-CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCAAAGAATCA-3 (reverse primer – VR1_t1)

5-CAGGAAACAGCTATGACTAGACTTCTGGGTGICCIAAIAAICA-3 (reverse primer – VR1i_t1)

These primers should be able to accommodate degeneracy occurring in the conserved regions as a result of evolutionary processes such as the ‘genetic drift’.

Results:

BLAST results:FASTA format for the top 2 matches

Sequence JF287131.1:

&gt.gi|325653673|gb|JF287131.1| Ephemerella subvaria voucher 08-SWRC-0922 cytochrome oxidase subunit 1 (COI) gene, partial cds. mitochondrial

ACTTTATACTTTATTTTCGGGGCTTGATCCGGCATAATTGGCACCTCTTTAAGTCTACTCATTCGGGCCGAACTGGGGCAACCTGGGTCCCTGATTGGAGATGACCAAATTTACAATGTCATCGTTACCGCCCATGCCTTCATTATAATTTTCTTTATAGTAATGCCTATTATAATTGGAGGATTTGGGAATTGGTTAGTGCCCCTCATACTCGGAGCTCCCGATATAGCTTTCCCCCGCATAAATAATATAAGCTTTTGACTTTTGCCTCCTGCCTTAACACTCCTATTAGCCAGTAGCATGGTAGAAAGAGGGGCGGGTACTGGTTGAACAGTTTACCCACCCCTGGCTTCCGGTATTGCTCATGCTGGAGGCTCTGTAGATCTCGCCATTTTCTCTCTTCACTTGGCTGGAGTCTCCTCTATTCTAGGAGCTGTGAACTTTATTACAACAACTATTAATATGCGGGCAAGAGGTATATCTATAGACCGGATTCCCCTTTTCGTATGATCTGTCCTAATTACAGCTATCTTACTTTTACTTTCTCTCCCAGTTTTAGCAGGAGCCATCACGATACTCCTCACTGACCGGAACCTTAATACATCCTTCTTTGACCCTGCTGGGGGAGGAGACCCCATTCTTTACCAGCATTTATTT

Sequence two JF287129.1.

&gt.gi|325653669|gb|JF287129.1| Ephemerella subvaria voucher 08-SWRC-0728 cytochrome oxidase subunit 1 (COI) gene, partial cds. mitochondrial

ACTCTATACTTTATTTTCGGGGCTTGATCCGGCATAATTGGCACCTCTTTAAGTCTACTCATTCGGGCCGAACTAGGGCAACCTGGGTCCCTGATTGGAGATGACCAAATTTACAATGTCATCGTTACCGCCCATGCCTTCATTATAATTTTCTTTATAGTAATGCCTATTATAATTGGAGGATTTGGGAATTGATTAGTGCCCCTCATACTCGGAGCTCCCGATATAGCTTTCCCCCGCATAAATAATATAAGCTTTTGACTTTTGCCTCCTGCCTTAACACTCCTATTAGCCAGTAGCATGGTAGAAAGAGGGGCGGGTACTGGTTGAACAGTTTACCCACCCCTGGCTTCCGGTATTGCTCATGCTGGAGGCTCTGTAGATCTCGCCATTTTCTCTCTTCACTTGGCTGGAGTCTCCTCTATTCTAGGGGCTGTAAACTTTATTACAACAACTATTAATATGCGGGCAAGAGGTATATCTATAGACCGGATTCCCCTTTTCGTATGATCTGTCCTAATTACAGCTATCTTACTTTTACTTTCTCTCCCAGTTTTAGCAGGAGCCATCACGATACTCCTCACTGACCGGAACCTTAATACATCCTTCTTTGACCCTGCTGGGGGAGGAGACCCCATTCTTTACCAGCATTTATTT

The top two matches in the BLAST database

Accession numbersequences name E valuequery coverage

1. JF287129.1Ephemerella subvaria 0.0 100%

voucher 08-SWRC-0728

cytochrome oxidase

subunit 1 (COI) gene,

partial cds. mitochondrial

2. JF287129.1Ephemerella subvaria

voucher 08-SWRC-0728 0.0 100%

cytochrome oxidase

subunit 1 (COI) gene,

partial cds. mitochondrial

The top two mathces in the BOLD database

Table 1: the first two results of the species level match made by sample #3 in the BOLD database

Phylum

class

order

Family

Genus

Species

Specimen similarity (%)

Arthropoda

Insecta

ephemeroptera

Ephemerellidae

Ephemerella

Subvaria

100

Arthropoda

Insecta

ephemeroptera

Ephemerellidae

Ephemerella

Subvaria

100

Discussion:

Insects are diverse in nature and present an interesting opportunity for a host of target groups such as taxonomist, conservationists and ecologists. The coming into place of the DNA technology and its bulging potential has revolutionarized the classification of organisms from the morphological perspective to a more advanced DNA taxonomy which requires DNA barcoding. It provides a novel sytem structured to provide a rapid and accurate species identification by use of short, standardized gene regions as species tag. Mayfly are a common feature in undisturbed freshwater bodies and are utilized by biomonitoring teams in establishing the water quality (Bauernfeind and Moog, 2000).

A match in the taxonomic ID and BOLD ID as evidenced by the BOLD and BLAST results. In some cases matches may fail to occur particularly when the sample is contaminated with DNA from other sources. These contaminants ultimately distort the outcome of the BLAST resulting yielding misleading results. False positives may also occur in queries done in the BOLD database where closely allied congeneric species which have not yet been established in the identification tree may appear in the results thereby resulting to a misleading clasification of the organism of interest.

References

Bauernfeind, E. and Moog, O. (2000). Mayflies (Insecta: Ephemeroptera) and the assessment

of ecological integrity : a methodological approach. Hydrobiologia 422:71-83

Hebert, P. D. N., A. Cywinska, S. L. Ball, and J. R. Dewaard. (2003a). Biological identifications

through DNA bar codes. Proceedings of the Royal Society of London B Biological Sciences 270: 313–321.

Hebert P.D.N., Stoeckle M.Y, Zemlak T.S., Francis C.M. (2004b). Identification of Birds

through DNA Barcodes. PLoS Biol 2: e312.

WHAT OUR CURRENT CUSTOMERS SAY

  • Google
  • Sitejabber
  • Trustpilot
Zahraa S
Zahraa S
Absolutely spot on. I have had the best experience with Elite Academic Research and all my work have scored highly. Thank you for your professionalism and using expert writers with vast and outstanding knowledge in their fields. I highly recommend any day and time.
Stuart L
Stuart L
Thanks for keeping me sane for getting everything out of the way, I’ve been stuck working more than full time and balancing the rest but I’m glad you’ve been ensuring my school work is taken care of. I'll recommend Elite Academic Research to anyone who seeks quality academic help, thank you so much!
Mindi D
Mindi D
Brilliant writers and awesome support team. You can tell by the depth of research and the quality of work delivered that the writers care deeply about delivering that perfect grade.
Samuel Y
Samuel Y
I really appreciate the work all your amazing writers do to ensure that my papers are always delivered on time and always of the highest quality. I was at a crossroads last semester and I almost dropped out of school because of the many issues that were bombarding but I am glad a friend referred me to you guys. You came up big for me and continue to do so. I just wish I knew about your services earlier.
Cindy L
Cindy L
You can't fault the paper quality and speed of delivery. I have been using these guys for the past 3 years and I not even once have they ever failed me. They deliver properly researched papers way ahead of time. Each time I think I have had the best their professional writers surprise me with even better quality work. Elite Academic Research is a true Gem among essay writing companies.
Got an A and plagiarism percent was less than 10%! Thanks!

ORDER NOW


Consider Your Assignments Done

“All my friends and I are getting help from eliteacademicresearch. It’s every college student’s best kept secret!”

Jermaine Byrant
BSN

“I was apprehensive at first. But I must say it was a great experience and well worth the price. I got an A!”

Nicole Johnson
Finance & Economics

Our Top Experts

See Why Our Clients Hire Us Again And Again!


OVER

10.3k
Reviews

RATING
4.89/5
Average

YEARS
13
Mastery

Success Guarantee

When you order form the best, some of your greatest problems as a student are solved!

Reliable

Professional

Affordable

Quick

Using this writing service is legal and is not prohibited by any law, university or college policies. Services of Elite Academic Research are provided for research and study purposes only with the intent to help students improve their writing and academic experience. We do not condone or encourage cheating, academic dishonesty, or any form of plagiarism. Our original, plagiarism-free, zero-AI expert samples should only be used as references. It is your responsibility to cite any outside sources appropriately. This service will be useful for students looking for quick, reliable, and efficient online class-help on a variety of topics.