Use this single strand of nucleic acid * 5′- ATGCTATCATTGACCTTGAGTTATTAA -3′ * and answer the following:
i) Is this a strand of DNA or RNA? How do you know?
ii) If DNA, what is the complementary strand?
iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?
iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?
v) If DNA and a base were inserted at the beginning of the 5′ end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)
vi) What would happen to the reading frame if three bases were inserted/deleted? Why?








Jermaine Byrant
Nicole Johnson



